1. LB Liquid Culture Medium
Materials for 100mL:
Tryptone: 1g
Yeast: 0.5g
NaCl: 1g
Anhydrous Ethanol: 10mL
Chloramphenicol: 0.3g
Steps:
① Add 1g of tryptone, 0.5g of yeast, and 1g of NaCl into a conical flask.
② Add 100mL of water, then gently shake the solution. This is the
nutrient medium.
③ Seal the flask with newspaper.
④ Autoclave the solution.
⑤ Mix 0.3g of antibiotics (chloramphenicol) and 10mL of anhydrous
ethanol in another conical flask.
⑥ Separate the solution using filter needles (1mL per centrifuge
bottle)
Step 7-8 needs to be done in the Biosafety Cabinet
⑦ Remove the sealed newspaper.
⑧ Dissolve 100μL of antibiotics into the nutrient medium. (Antibiotics:
solution=1:1000)
2. LB Solid Culture Medium
Materials for 100mL:
Tryptone: 1g
Yeast: 0.5g
NaCl: 1g
Agar: 1.5g
Anhydrous Ethanol: 10mL
Chloramphenicol: 0.3g
Steps:
① Add 1g of tryptone, 0.5g of yeast, 1g of NaCl, and 1.5g of agar into
a conical flask.
② Add 100mL of water, then gently shake the solution. This is the
nutrient medium.
③ Seal the flask with news paper
④ Autoclave the solution.
⑤ Mix 0.3g of antibiotics (chloramphenicol) and 10mL of anhydrous
ethanol in another conical flask.
⑥ Separate the solution using filter needles (1mL per centrifuge
bottle).
Step 7-8 needs to be done in the Biosafety Cabinet
⑦ Remove the sealed newspaper.
⑧ Dissolve 100μL of antibiotics into the nutrient medium. (Antibiotics:
solution=1:1000)
⑨ Evenly distribute the nutrient medium into three petri dishes.
⑩ Wait for 20min for nutrient medium to cool, then invert the petri
dish to prevent condensation of water from dropping.
⑪ Wrap Petri dish with plastic wrap.
3. DNA PCR
Materials for 50μL PCR system:
Taq Enzyme: 25μL
Template: 1μL
Forward Primer: 1μL
Reverse Primer:1μL
Double Distilled Water: 22μL
Steps:
① Add 22μL of Taq enzyme, 1μL of templated DNA, 1μL of forward primer,
1μL of reverse primer, and 22μL of double distilled water into a PCR
tube.
Protocol of DNA PCR: preheat at 98℃ for 3 min; Replicate the
following steps for 30 times: heat at 98℃ for 10s, anneal at 55℃ for 15s,
extend at 72℃ for 50s (at a speed of about 5sec/kb); extend
at 72℃ for 5min.
② Store the products at 4℃.
Table 1Primer sequences for DNA PCR and colony PCR
|
Primer
|
Primer sequence
|
|
X-pMTL-F
|
GACTATTCCTCCTAAATATTTATGGATCC
|
|
X-pMTL-R
|
ctctagagtcgacgtcacgc
|
|
F/Xpk(QS)-F
|
CATAAATATTTAGGAGGAATAGTCATGACGAGTCCTGTTATTGG
|
|
F/Xpk(QS)-R
|
ggacgcgtgacgtcgactctagagTCACTCGTTATCGCCAGC
|
|
F/Xpk (BD)-F
|
ATAAATATTTAGGAGGAATAGTCATGCAAAGTATAATAGGAAAACAT
|
|
F/Xpk (BD)-R
|
cgcgtgacgtcgactctagagTTATACATGCCACTGCCAATTAG
|
|
J-F/Xpk(QS)-F
|
ATGACGAGTCCTGTTATTGGC
|
|
J-F/Xpk(QS)-R
|
CGACGAACTCGTACGGCT
|
|
J-F/Xpk(BD)-F
|
ATGAAGCCTTCCTTCGTATTG
|
|
J-F/Xpk(BD)-R
|
gtcacgacgttgtaaaacgac
|
|
X-PN-F
|
cccgggtaccgagctcgaattc
|
|
X-PN-R
|
GGATCCATAAATATTTAGGAGGAATAGTC
|
|
P-Pfba-F
|
gaattcgagctcggtacccgggCAACATATAAGATTCAAAAATAAGGAAGAAGC
|
|
P-Pfba-R
|
CCTCCTAAATATTTATGGATCCTTTTATTCCACCCTTCGAAAATTTTATT
|
|
P-Ptkt-F
|
cgaattcgagctcggtacccgggTATGAACAATATAGTGTTGAAAAAAAATCCATC
|
|
P-Ptkt-R
|
CCTCCTAAATATTTATGGATCCATAGAATTTTCACTCCTTAGTTTTTTATTTAAAAACC
|
|
CX
|
TACTTGTCCACCATGACCT
|
4. Gel Electrophoresis
Materials for 60mL Gel: (Agrose: TAE=1:1000)
Agrose: 0.6g
TAE solution: 60mL
Loading Buffer: 6μL (Loading Buffer: Solution=1:10000)
Steps:
① Mix 0.6g of Agarose and 60mL of TAE solution. (Agarose: TAE=1:100)
② Heat the solution using microwave oven. (Medium high/1min)
③ Add 6μL of loading buffer, and mix.
④ Connect the gel-tank with comb (8 keys, each key creates 50μL
trough), and pour the solution to the tank.
⑤ Wait until the gel is dry, and gently remove the comb.
⑥ Place the gel in the electrophoresis tank with the trough close to
the cathode (Black), and ensure that the gel is soaked in running
buffer.
⑦ Load marker and samples.
⑧ Program and run the gel at 110V for about 30min
⑨ Leave the machine running after visualizing little bubbles coming out
of cathode.
5. Gel Recovery
Materials for 60mL Gel: (Agrose: TAE=1:1000)
Buffer GDP: 300μL+xμL (xng=xμL)
Buffer GW with Ethanol: 1400μL
Double Distilled Water: 30μL
Steps:
① Under E-Gel Imager cut off the part of the gel that contains the
target DNA. Remove as much gel as possible to seek for higher
concentration.
② Transfer the gel that contains the target DNA into a centrifuge tube.
③ Measure the weight of the gel. Then add xμL of buffer GDP. (xng=xμL)
④ Heat the centrifuge tube at 55°C using water bath to melt the gel for 7min.
⑤ Place DNA mini absorbing column-G inside the collection tube.
⑥ Transfer the solution of melted gel and GDP into the absorbing column
(700μL max).
⑦ Centrifuge the solution at 12000rpm for 1min.
⑧ Discard the filtrate in the collection tube, and add 300μL of buffer
GDP.
⑨ Let the centrifuge tube stand for 1min, and centrifuge the solution
at 12000rpm for 1min.
⑩ Discard the filtrate in the collection tube, add 700μL of buffer GW
with anhydrous ethanol into the absorbing column, and centrifuge at
12000rpm for 1min.
⑪ Repeat Step 10.
⑫ Discard the filtrate in the collection tube, and centrifuge at
12000rpm for 2min.
⑬ Discard the filtrate and the collection tube. Place the absorbing
column into a centrifuge tube.
⑭ Add 30μL of double distilled water. Make sure the double distilled
water covers the membrane of the absorbing column.
⑮ Let the centrifuge tube stand for 2min, close the tube cover, and centrifuge at 12000rpm for 1min.
6. DNA Ligation
Materials for 10μL Ligation System:
Fragment: 1.5 μL
Vector: 2μL
Ligase Buffer: 2μL
Ligase: 1μL
Double Distilled Water: 3.5μL
Steps:
① Calculate the system, and add all the components into a PCR tube.
② Place the tube in a water bath at 37°C for 30min.
7. Preparation of competent cells
Materials：
LB liquid medium: 65mL
Bacteria colony
PBS: 20mL
0.1M CaCl2 solution: 22mL
Glycerol: 2mL
Steps:
① Coat the bacteria on the LB plate, and put the plate in the 37°C
incubator for 12-16h to wait for the colony to grow to 1-2mm in
diameter.
② Pick a colony from the above bacteria plate, inoculate 10-15mL LB
liquid medium with the colony, and oscillate and culture at 37°C for
12-16h.
③ Transfer 0.5mL of the above activated bacteria into 50mL LB liquid
medium, oscillate at 37℃ till OD600=0.5.
④ Transfer the bacteria culture from step 3 into a 50mL centrifuge
tube, place the tube on ice for 10min, and centrifuge at 4000rpm 4°C
for 10min.
⑤ Discard the supernatant, add 10mL of PBS, resuspend the cells by
aspiration, and centrifuge at low speed for 5min.
⑥ Repeat step 5.
⑦ Discard the supernatant, add 10mL of 0.1M CaCl2
solution, puff and resuspend, and place the tube on ice for 30min.
Centrifuge at 5000rpm for 5min and discard the supernatant.
⑧ Repeat step 7.
⑨ Add 2mL of CaCl2
solution, place the tube on ice for 10-30min, and add 2mL of
glycerol.
8. Transformation of E. coli
Materials:
Calcium chloride:250μL
Plasmid: 10μL
LB liquid culture medium: 250μL
LB solid culture medium
Steps:
① Add 250μL of cold calcium chloride into a 1.5mL centrifuge tube.
② Pick 5 bacteria colonies from the petri dish, add them to the
centrifuge tube, and stir to suspend the cells.
③ Add 10μL of target plasmid into the centrifuge tube, and sit on ice
for 15min.
④ Heat shock the tube at 42℃ for 90s, and place it back on ice for 2min.
⑤ Add 250μL of LB liquid medium, and culture at 37℃ for 1h.
⑥ Plate the bacteria on LB solid medium, invert and culture at 37℃ for 12h.
9. Transformation of Clostridium tyrobutyricum
Materials:
Donor strain: E. coli CA434
Recipient strain: Clostridium tyrobutyricum
Steps:
① Grow E. coli CA434 with the target plasmid in LB liquid medium with
30μL/mL of chloramphenicol till OD600 reaches 1.5-2.0.
② Transfer 3mL of E. coli CA434 to a tube, and centrifuge at 4000×g for
2min.
③ Wash with 1mL of 50mM PBS (pH 7.0) twice.
④ Resuspend the donor bacteria with 0.3mL of the recipient bacteria
(OD600=2.0-3.0).
⑤ Spread the cell mixture on a dry RCM agar plate, and incubate it for
20 h in an anaerobic bag at 37°C.
⑥ Dissolve the colonies grown on the plate with 600mL PBS (pH 7.0),
re-spread on a RCM plate containing 15μL/mL of thiamphenicol and
250μg/mL of D-cycloserine, and culture anaerobically at 37°C to
eliminate residual E. coli CA434.
⑦ Incubate the plates for 48-96h until obvious colony growth is
observed.
⑧ Randomly pick 10 single colonies and culture in RCM medium with
15μg/mL thiamphenicol anaerobically at 37°C for 8-10h.
⑨ Take about 1μL of the above bacteria for colony PCR identification.
⑩ For the positive colony, take an appropriate amount of bacterial
solution and expand it in fresh RCM medium containing 15μg/mL
thiamphenicol.
10. Colony PCR
Materials for 10μL PCR System:
Taq Enzyme: 5μL
Template: One colony on the Petri dish
Forward Primer: 0.2μL
Reverse Primer: 0.2μL
Double Distilled Water: 4.6μL
Steps:
① Add 5μL of Taq enzyme, one colony of template DNA, 0.2μL of forward
primer, 0.2μL of reverse primer, and 4.6μL of double distilled water
into a PCR tube.
Protocol of DNA PCR: preheat at 98℃ for 3 min; Replicate the
following steps for 30 times: heat at 98℃ for 10s, anneal at 55℃ for 15s,
extend at 72℃ for 50s (at a speed of about 5sec/kb); extend
at 72℃ for 5min.
② Store the products at 4℃.
Table 1 Primer sequences
|
Primer
|
Primer sequence
|
|
J-QS-FX-F
|
ATGACGAGTCCTGTTATTGGC
|
|
J-QS-FX-R
|
CGACGAACTCGTACGGCT
|
|
CX-FXpk-BD-F3
|
ATGAAGCCTTTCCTTCGTATTG
|
|
CX- FXpk -R
|
gtcacgacgttgtaaaacgac
|
11. Bacteria Preservation
Materials:
Glycerol: 900μL
Bacteria Fluid: 900μL
Steps:
① Add 900μL of glycerol in a tube.
② Add 900μL of bacterial fluid.
③ Store it in a refrigerator at -24°C.
12. Plasmid extraction
Materials:
E.coli solution: 2mL
Buffer P1: 250μL
Buffer P2: 250μL
Buffer P3: 350μL
Buffer PW2: 1200μL
ddH2O: 21μL
Steps:
① Add 2mL of logarithmic E. coli solution to a centrifuge tube,
centrifuge at 10000 rpm (11500×g) for 1min, discard the medium, and
absorb the residual liquid with a paper towel.
② Add 250μL Buffer P1 (RNase A added) to the tube with the bacterial
pellet, and mix well with a pipette.
③ Add 250μL Buffer P2 to step 2 and invert the tube 8-10 times gently
until the solution becomes viscous and translucent.
④ Add 350μL Buffer P3 to step 3, immediately gently invert the tube
8-10 times, centrifuge at 12000 rpm (13400×g) for 10min after a white
flocculent pellet appears.
⑤ Place the adsorption column in a 2mL collection tube.
⑥ Carefully transfer the Step-4 supernatant to the adsorption column
with a pipette, centrifuge at 12000 rpm (13400×g) for 60s, drain the
waste from the collection tube, and place the adsorption column back
into the collection tube.
⑦ Add 600μL Buffer PW2 (diluted with absolute ethanol) to the
adsorption column, centrifuge at 12000 rpm (13400×g) for 30-60s,
discard the waste liquid and put the adsorption column back into the
collection tube.
⑧ Repeat step 7.
⑨ Centrifuge the adsorption column at 12000 rpm (13400×g) for 1min to
dry the adsorption column and completely remove the residual rinse
solution in the adsorption column.
⑩ Place the adsorption column in a new sterilized 1.5mL centrifuge
tube. Add 21μL ddH2O to the center of the membrane attached to the
column. Sit at room temperature for 2min and rinse DNA by
centrifugation at 12000 rpm (13400×g) for 1min.
⑪ Discard the adsorption column and store the DNA product at -20°C to prevent DNA degradation.
13. Restriction enzymes
Materials:
10×Quick Cut Green Buffer: 5μL
XhoI: 1μL
Plasmid: 1μL
ddH2O: 50μL
Steps:
Prepare 50μL digestion system: Add 5μL of 10×Quick Cut Green Buffer,
1μL of XhoI, and 1μL of plasmid to a PCR tube, and add ddH2O to
50μL.
Put the PCR tube into the thermal cycler and set the program to 37°C
for 1h + 80°C for 20min.
14. High-performance liquid chromatography (HPLC)
Steps:
Add bacterial in 700µl medium to a 2mL centrifuge tube and centrifuge at 10000rpm for 1min.
Take out supernatant and filter through a 0.22 micron membrane in a chromatographic sample bottle. Measure the concentrations of sugars, butyric acid and acetic acid by HPLC.
Use Aminex HPX-87H Columns (100 mm × 7.8 mm, BioRad, Marnes La coquette) and maintain at 65℃ with a mobile phase of 5 mM H2SO4 and a flow rate of 0.6mL/min.
Put the PCR tube into the thermal cycler and set the program to 37°C
for 1h + 80°C for 20min.
15. Acetyl phosphate (AcP) assay
Reagent preparation:
① Hydroxylamine solution: 4M hydroxylamine hydrochloride:3.5M NaOH=1:1,v/v
② Ferric chloride solution: 5% ferric chloride :12% trichloroacetic acid :3M HCl=1:1:1,v/v/v
Steps:
① Wash the bacteria in the early stage of stabilization twice with PBS(10mM,pH 7.2-7.4) and sonicate the bacteria.
② Centrifuge the fragmented cells (12000rpm for 5min), then place the supernatant on ice for later use;
③ Take 500µL supernatant, add 250µL hydroxylamine solution, and leave it at room temperature for 30min;
④ Add 750µL ferric chloride solution for color development, and stand in the shadow at room temperature for 10min;
⑤ The absorbance value was measured at 540nm.
Remarks: The standard concentrations used for the standard curves were 0mM, 3mM, 6mM, 9mM, 12mM, and 15mM.
The standard curve was: y=0.2162x+0.0752(R2=0.9948)