Skip to content

Protocols

1. In Silico Simulation of HIS1–Substrate Docking

  • Perform molecular dynamics (MD) using GROMACS (AMBER99SB-ILDN, TIP3P water model):
  • Energy minimization → 100ps NVT → 100ps NPT → 5ns production run.
  • Assess trajectory quality via RMSD, RMSF, and radius of gyration; confirm equilibration (~1ns).
  • Calculate per-residue solvent-accessible surface area (SASA) using gmx sasa; classify residues as exposed (>0.2nm²).
  • Construct a polypropylene (PP) decamer in Open Babel.
  • Perform Autodock Vina docking using the final MD structure as the receptor (search box = full surface).
  • Generate 20 poses; identify residue–ligand contacts within 4–6Å.
  • Exclude residues within 6Å of cofactors (Fe²⁺, 2-oxoglutarate; from PDB 8s7b), buried (low SASA), or highly flexible (RMSF > 0.25nm).
  • Use FoldX to compute ΔΔG per hydrophobic substitution; rank residues by mutational stability.

2. Sub-Cloning and Expression of HIS1

Host: E. coli BL21(DE3)
Plasmid: pET28-A–HIS1

  • Inoculate 5mL LB + 5µL kanamycin from glycerol stock; incubate overnight (37°C, 200rpm).
  • Transfer 2mL to 200mL TB + 200µL kanamycin; grow (30°C, 180rpm) until OD₆₀₀ = 0.8–0.9.
  • Chill culture on ice (20 min).
  • Add cofactors: 2mM FeSO₄ and 6mM 2-oxoglutarate.
  • Induce with 0.4mM IPTG; incubate (20°C, 200rpm, 20h).
  • Harvest cells (10,000 × g, 20 min, 4°C); discard supernatant.
  • Store pellets at –20°C.

3. Mutant Library Synthesis

3.1 Two-Phase Mutagenesis Strategy

  • Target residues: 110, 148, 268, 297, 304, 305, 307.
  • Use degenerate codon DTN for hydrophobic substitutions.
  • Two-phase mutagenesis planned to minimize library size (deferred due to screening delay).

3.2 Vector Amplification

  • Purify pET28-A using QIAprep Miniprep.
  • Digest with EcoRI and HindIII (1µL each, 1h).
  • Verify by 0.8% agarose gel; extract the target band.
  • Measure DNA concentration with Nanodrop.

3.3 Site-Directed Mutagenesis

(a) Degenerate Codon Substitution (BsaI)
  • Primers: PPase_Fs and PPase_Rs.
  • Run PCR → visualize on 0.8% agarose gel.
  • No visible bands → method discontinued.
(b) Mutant Megaprimer Method
  • Design mutagenic primers with DTN codon (Tm = 60°C).
  • Perform asymmetric PCR (100:1 primer ratio; 35 cycles, 65°C annealing).
  • Run symmetric PCR as a control.
  • Digest products with DpnI (1µL); purify (Promega Wizard® kit).
  • Pool and concentrate 6 × 50µL reactions; measure DNA concentration.
  • Generate full-length genes using mutant megaprimers as reverse primers.
  • Digest (EcoRI + HindIII, 1h), purify, verify by gel, and quantify DNA.

Primer Sequences

Purpose Primer Name Primer Sequence
Cloning (non-mutagenic) PPase_F ACTGGAATTCCCTGGTGCCACGCG
PPase_R CTAAATACGCAGGCTATCAATATAGCGTTC
Combinatorial mutagenesis PPase_110_F CGCAAACAGAAATTCAGCdtnCTGATCGATGGCAAGAAC
PPase_148_F CGTGTGGAACCGAAAdtnGAACAGGATCTGGCATTTTG
PPase_268_F CTGCTGATTAATCTGGGTdtnACAATGGAAGTTATGTGC
PPase_297_F GAAAAAGAACGTATTAGCCTGdtnATGCTGTATAGCGTGAATG
PPase_304_F CAATGCTGTATAGCGTGAATdtnGAGAAAGATATTGAACCTGCC
PPase_305_F GCTGTATAGCGTGAATGATdtnAAAGATATTGAACCTGCCG
PPase_307_F GTATAGCGTGAATGATGAGAAAdtnATTGAACCTGCCGC
Single-site mutagenesis PPase_Fs atcGGTCTCttcagcdtnCTGATCGATGGCAAGAACTTT
PPase_Rs ATCggtctcGCTGAATTTCTGTTTGCGTTC

4. Ligation, Transformation, and Sequencing

Ligation: - Set up 20µL reactions with T4 DNA ligase (+/– insert, +/– ligase controls).
- Incubate 1h at room temperature.

Transformation: - Mix 10µL ligation mix + 100µL competent E. coli.
- Controls:
- Positive: 50µL cells + 1µL template DNA.
- Negative: 50µL cells only.
- Ice (15 min) → Heat shock (42°C, 1 min) → Ice (1 min).
- Add 250µL SOC; incubate (37°C, 1 h).
- Plate 50µL onto LB agar; incubate overnight (37°C).

Sequencing: - Send 6 colonies (+L+I plates) for Sanger sequencing using PPase_F/R primers.

5. HIS1 Protein Purification

  • Lysis buffer: 20mM Tris-HCl, 100mM NaCl, 2.5mM MgCl₂, 0.5mM CaCl₂
  • Binding buffer: 20mM Tris-HCl, 0.1mM MgCl₂
  • Wash buffer: 20mM Tris-HCl, 10mM Imidazole, 200mM NaCl, 0.1mM MgCl₂

  • Elution buffer: 20mM Tris-HCl, 500mM Imidazole, 50mM NaCl, 0.1mM MgCl₂

  • Resuspend pellet in 20mL BugBuster®; incubate 30 min (RT).

  • Centrifuge (40,000 × g, 30 min, 4°C); retain supernatant.
  • Equilibrate Ni-Sepharose column with 30mL water → 30mL binding buffer.
  • Load lysate; collect flow-through.
  • Wash with 10mL wash buffer until A₆₀₀ ≈ 0.
  • Elute with elution buffer (1mL fractions) until A₆₀₀ ≈ 0.
  • Pool fractions with the highest absorbance; quantify protein.
  • Clean column (Tris + Imidazole → MilliQ → 20% EtOH).
  • Concentrate pooled elution with Vivaspin® to ≤ 0.5mL; exchange into HEPES buffer (repeat until Imidazole < 3mM).
  • Verify by SDS-PAGE.

6. Polypropylene Degradation Assay

  • Lyse cells in BugBuster® (30 min, RT) → centrifuge (40,000 × g, 30 min, 4°C).
  • Discard pellet; incubate supernatant with 5mg polypropylene, 2mM FeSO₄, 6mM 2-oxoglutarate in pH 7 buffer at 30°C.
  • Replace enzyme + cofactors every 24h.

7. KMnO₄ Oxidation of Polypropylene

  • Clean samples (acetone + ethanol, ultrasonic bath); dry 50°C, 1h.
  • Treat with 0.5M HCl / 0.25M KMnO₄ at 45°C for 2–8h.
  • Rinse with water until colorless.
  • Remove MnO₂ deposits using a 12M HCl rinse.

8. Colorimetric Quantification of Surface Carboxyl Groups (PV-Ni Assay)

Reagents: Pyrocatechol violet (PV), Ni²⁺, 10mM HEPES pH 7
- Rinse samples thoroughly with HEPES buffer.
- Incubate plastics with 400µM Ni²⁺ in 10mM HEPES (25°C, 2 min).
- Transfer liquid → add PV (final concentration = 40µM).
- Measure absorbance at 650nm.
- Controls: KMnO₄-oxidized (positive), untreated PP (negative).
- Adapted for 96-well PP plates (transfer to flat-bottom plates for reading).
- LOD = (3.3 × s_blank) / m
- LOQ = (10 × s_blank) / m

9. Toluidine Blue O (TBO) Staining to Quantify Surface Organic Compounds

  • Treat PP microtubes with enzyme solutions (HIS1/EV + cofactors) at 30°C for 48h.
  • Ultrasonically clean (1% SDS → water → 75% EtOH); dry at ~50°C 1h.
  • Incubate in 0.1% TBO / 1mM NaOH (40°C, 15 min, 250rpm).
  • Wash in 1mM NaOH until supernatant is clear (~4×).
  • Desorb dye with 20% SDS (40°C, 30 min, 250rpm).
  • Measure absorbance at 630nm.
  • Adaptable to KMnO₄-treated 96-well plates (same steps).

10. Surface Contact Angle (SCA) Measurement

  • Clean PP pieces (70% EtOH → water); dry (55°C, 1h).
  • Measure initial contact angles using 7µL water droplets (2 min per run).
  • Treat plastics with HIS1 or EV lysate (overnight) or KMnO₄ (4–8h).
  • Post-treatment cleaning: sonicate in 1:10 IPA + water (3 min), wash (EtOH + water), dry (55°C).
  • Re-measure daily for 5 days (replace reaction mixture every 24h).

11. FTIR Analysis

  • Clean 1cm × 1cm PP films (1% SDS → water → EtOH); dry (50°C, 1h).
  • Perform FTIR (Dr. Simone Dimartino’s lab, Bioengineering, UoE).

12. AFM Analysis

  • Prepare 6mm PP discs; treat with buffer, HIS1, HIS1 lysate, or EV lysate.
  • Clean (1% SDS → water → EtOH); dry (50 °C, 1 h).
  • Acquire AFM images at 1 µm and 10 µm scales (1 Hz scan, 256 × 256 pixels).
  • Analyze surface roughness and thickness.

13. GC-MS Analysis

  • Treat 5mg PP films with purified HIS1 or HEPES control (72h, 30°C); replace mixtures daily.
  • Pool reactions; add 3:1 cold methanol, incubate on ice (30 min).
  • Centrifuge (12,000rpm, 30min, 4°C); collect supernatant.
  • Add 10% DCM; inject 1µL onto DB-5ms column (40m × 250µm × 0.25µm).
  • Carrier: helium (1mL/min), 70eV ionization.
  • Analyse chromatograms and identify peaks via NIST library.

14. TLC Analysis of HPP Breakdown

  • Prepare 300µL HIS1/EV lysates and 0.5mg/mL pure HIS1/HEPES reactions (2mM FeSO₄, 6mM 2-oxoglutarate, 6mM HPP or no HPP as control).
  • Incubate 30°C, 24h.
  • Spot samples on silica gel TLC plates.
  • Run in ethyl acetate:hexane:acetic acid = 70:30:2.
  • Air dry; visualize under UV light.