Skip to content

Protocols

Primer Sequences

Primer Sequence (5’--> 3’)
Genomic Forward GF CAGTGAAGACATAATGAATTCATCCCTTGTGATCC
Genomic Reverse GR CAGTGAAGACATAAGCATTGGCGATCGCCTACAT
Level 0 Forward L0F TTGAGTGAGCTGATACCGCT
Level 0 Reverse L0R GTCTCATGAGCGGATACATATTTGAATG
Level 1 Forward L1F GAACCCTGTGGTTGGCATGCACATAC
Level 1 Reverse L1R CTGGTGGCAGGATATATTGTGGTG
Level T Forward LTF TAGTGAGTGGGTTGCGCTC
Level T Reverse LTR GTTACCACCGCTGCGTTC
P1 Primer P1 AGGGCGGCGGATTTGTCC
P2 Primer P2 GCGGCAACCGAGCGTTC

Preparation of NaCl Lysogeny Broth and BL21 Growth Curve

  1. Prepare Sterile 34% (w/v) Saline stock solution
  2. Add Saline solution in increasing amounts to LB to a falcon tube to create medium of varying salt concentrations and then inoculate with 1ml of overnight culture BL21 using the table below:
Concentration of NaCl in LB media (w/v) Volume of 34% Saline Solution (mL) Volume of LB media (mL) Volume of BL21 in LB
0.5% 0 29 1
1% 0.441 28.559 1
1.5% 0.882 28.118 1
2% 1.323 27.677 1
2.5% 1.764 27.236 1
3% 2.205 26.795 1
3.5% 2.646 26.354 1
4% 3.087 25.913 1
4.5% 3.528 25.472 1
5% 3.969 25.031 1
5.5% 4.380 24.590 1
6% 4.821 24.149 1
  1. Take an initial OD600 from each of the cultures
  2. Incubate the cultures at 37°C 250rpm
  3. Take a 1ml sample every hour and record the OD600 of each culture. If the OD600 of a culture is significantly more than 1, dilute the sample and measure the OD600.

Preparation of TOP10 and BL21 Competent cells

  1. Pick a single colony of TOP10 or BL21 and inoculate 10ml LB before culturing overnight at 37°C 250rpm
  2. Inoculate 100ml of LB with 1ml of this overnight culture
  3. Incubate at 37°C 200rpm until the OD600 is between 0.3 and 0.6
  4. Transfer equal volumes of the media into 2x 50ml falcon tubes and leave on ice for 30 minutes
  5. Centrifuge at 4000g at 4°C for 5 minutes
  6. Pour off the supernatant and gently resuspend the pellet in 25ml ice cold 0.1M MgCl2
  7. Incubate on ice for 30 minutes
  8. Centrifuge at 4000g at 4°C for 5 minutes
  9. Pour off the supernatant and gently resuspend the pellet in 25ml ice cold 0.1M CaCl2
  10. Incubate on ice for 30 minutes
  11. Centrifuge at 4000g at 4°C for 5 minutes
  12. Pour off the supernatant and gently resuspend the pellet in 1.25ml ice cold 0.1M CaCl2/Glycerol solution (1.7ml 0.1M CaCl2, 0.3ml 100% Glycerol)
  13. Aliquot 100 μl and flash freeze on dry ice or on liquid nitrogen before storing at -80°C

PCR Extraction of ggpS from synechocystis sp. PCC 6803 Genome

  1. Centrifuge 200μl of synechocystis culture In a microcentrifuge at 13,000rpm for 1 minute.
  2. Drain the supernatant and resuspend the pellet in 200μl double distilled water.
  3. Transfer 20μl of this to a PCR tube and freeze at -20°C for 10 minutes to lyse the cells.
  4. Create a reacton mix using the following:
Reaction Component Volume
5x Q5 Reaction Buffer 5μl
10mM dNTP mix 0.5μl
10μM GF Primer 1.25μl
10μM GR Primer 1.25μl
Lysed Synechocystis 10μl
Q5 Polymerase (Add Last) 0.25μl
ddH2O 6.75μl
  1. Run the PCR reaction with the thermocycler set to run an initial denaturation of 98°C for 30 seconds followed by 35 cycles of 98°C for 10 seconds, 66°C for 30 seconds and 72°C for 30 seconds before a final extension at 72°C for 2 minutes and hold the reaction at 4°C.
  2. Make a 1% Agarose Gel and run the reaction product using Gel electrophoresis.
  3. Extract the product of the correct size using the QI-Aquick gel extraction kit (Qiagen)

Cyanogate level 0 Assembly

  1. Create a reaction mix in a PCR tube with the following components:
Reaction Component Amount
ggpS gene insert 200 ng
PICH41308 acceptor vector 100 ng
10x T4 ligase buffer 2μl
bbsI-HF 1μl
T4 Ligase - HF 1μl
ddH2O Fill to 20μl
  1. Set the Thermocycler to run in the following cycles: 15 cycles of 10 minutes at 37°C then 10 minutes at 16°C followed by one cycle at 37°C for 20 minutes and one cycle at 65°C for 10 minutes and hold at 16°C.

Cyanogate level 1 Assembly

  1. Create a reaction mix in a PCR tube with the following components:
Reaction Component Amount
ggpS level 0 200 ng
PTRC10 Promoter level 0 200 ng
pC0.082 terminator level 0 200 ng
pICH47732 acceptor vector 100 ng
10x T4 ligase buffer 2μl
Bovine Serum Albumin 2μl
BsaI-HF 1μl
T4 Ligase - HF 1μl
ddH2O Fill to 20μl
  1. Set the Thermocycler to run in the following cycles: 15 cycles of 10 minutes at 37°C then 10 minutes at 16°C followed by one cycle at 37°C for 20 minutes and one cycle at 65°C for 10 minutes and hold at 16°C.

Cyanogate stpA level T Assembly

  1. Create a reaction mix in a PCR tube with the following components:
Reaction Component Amount
stpA Gene block 200 ng
pSEVA421 acceptor vector 100 ng
10x T4 ligase buffer 2μl
Bovine Serum Albumin 2μl
BbsI-HF 1μl
T4 Ligase - HF 1μl
ddH2O Fill to 20μl
  1. Set the Thermocycler to run in the following cycles: 15 cycles of 10 minutes at 37°C then 10 minutes at 16°C followed by one cycle at 37°C for 20 minutes and one cycle at 65°C for 10 minutes and hold at 16°C.

Plasmid transformations

  1. Make 50μl aliquots of BL21 or TOP10 cells
  2. Add 5μl of assembly reaction mix or 1μl of plasmid miniprep
  3. Incubate these cells on ice for 30 minutes
  4. In a water bath, heat shock the cells at 42°C for 30 seconds
  5. Return the cells to ice for 2 minutes
  6. Add 450μl SOC media and incubate the cells at 37°C 200rpm for 1 hour
  7. Spread 50μl of the incubated cells on a plate with the correct antibiotic and for cyanogate containing IPTG and X-GAL for blue/white selection
  8. Spin the remaining cells at 6000rpm for 1 minute in a microcentrifuge
  9. Without disturbing the pellet remove the supernatant leaving 50μl of media behind
  10. Resuspend the pellet in the remining media
  11. Spread the remaining cells onto another LB agar plate as before.
  12. Incubate the cells overnight at 37°C

Confirmation of Plasmid Assembly and Transformation by Colony PCR

  1. Check the plates from the overnight culture. Colonies for cyanogate will have blue/white selection and colonies with the lacZ gene transformed will appear as white. For a JUMP assembly expose the plate to UV and the colonies will fluoresce if transformed with the GFP gene.
  2. Pick these white or fluorescent colonies and resuspend them in 50μL ddH20 in a PCR tube.
  3. Take 40ml of this and inoculate 1ml LB with this to create a stock of that colony
  4. Freeze the remaining 10μl in the PCR tube at -20°C for 10 minutes
  5. Create a reaction mix in a PCR tube with the following components:
Reaction Component Amount
Lysed Cells 10μl
5x Green GoTaq Buffer 5μl
10mM dNTP mix 0.5μl
10μM Forward Primer 2μl
10μM Reverse Primer 2μl
GoTaq G2 DNA Polymerase 0.125μl
ddH2O Fill to 25μl
  1. Set the thermocycler to run the following cycles: Initial denaturation step of 95°C for 2 minutes and then 35 cycles of 95°C for 1 minute, annealing at 42-65°C depending on the primer and an extension at 72°C for 2 minutes (1Min/Kb) with a final extension of 72°C for 5 minutes and finally hold at 4°C.
  2. Take the PCR product and run on 1% Agarose gel by gel electrophoresis and use a UV imager to image the bands on the gel, confirming bands of the expected size.

JUMP Level 1 Assembly

  1. Create a reaction mix in a PCR tube with the following components:
Reaction Component Amount
ggpS epPCR digest (20fmol/μl) 1μl
pJUMP29-1A acceptor vector (20fmol/μl) 1μl
PJ23100 Promoter in level 0 (20fmol/μl) 1μl
L3SAP51 terminator in level 0 (20fmol/μl) 1μl
pET Ribosome Binding Site in level 0 (20fmol/μl) 1μl
T4 DNA ligase - HF 0.25μl
BsaI-HF 1μl
T4 Ligase Buffer 2μl
ddH2O Fill to 20μl
  1. Set the Thermocycler to run in the following cycles: 1 cycle at 37°C for 15 minutes then 25 cycles at 37°C for 3 minutes and 16°C for 3 minutes. Then 1 cycle of 37°C for 15 minutes, 50°C for 5 minutes and 80°C for 5 minutes before a further 25 cycles of 37°C for 3 minutes and 16°C for 3 minutes and 1 cycle of 37°C for 15 minutes, 50°C for 5 minutes and 80°C for 5 minutes and finally hold the reaction at 4°C.

Error Prone PCR

  1. Create a reaction mix in a PCR tube with the following components:
Reaction Component Amount
10x NEB Taq DNA polymerase Thermopol buffer 5μl
Genomic Forward Primer 1μl
Genomic Reverse Primer 1μl
Taq polymerase 0.5μl
ggpS Level 0 Template DNA 50ng
MgCl2 2.95mM
MnCl2 0.1mM
ddH2O Fill to 50μl
  1. Set the thermocycler to have an initial denaturation at 95°C for 1 minute, 25 Cycles of 30 seconds at 95°C, 45 seconds at 53°C and 90 seconds at 68°C, a final elongation at 68°C for 5 minutes and hold at 4°C
  2. Puridy the product with the Monarch DNA Gel Extraction kit (New England Biolabs) and store at -20°C